Practical - Similary searches
Search for homologous proteins using BLASTP (NCBI BLAST)
We want to find homologs of a bat protein sequence available on moodle.
Composition
What can you say about the composition of this protein sequence? What problem can be encountered in a similarity search with such a composition?
Databases
Exercise 1 Which databases are available for the search?
Select the SwissProt database.
Exercise 2 Will the search be exhaustive?
BLASTP parameters
See Algorithm parameters, at the bottom of the page.
Exercise 3 How many sequences can you get?
Exercise 4 What is the Expect threshold to display sequences? Modify the Expect threshold to obtain results with E≤10.
Exercise 5 What are the gap penalties? The word size?
Exercise 6 How are regions of low complexity processed?
Perform the similarity search (SwissProt, E≤10, default for other parameters)
Graphic summary
Exercise 7 How many sequences do you obtain with E≤10?
Exercise 8 What can be deduced from the graphical representation of BLAST results? There is no alignment on the C-terminal region. Why?
Description
Exercise 9 Which families are detected?
Taxonomy
Exercise 10 In which organisms do you find hits?
Exercise 11 In which species is the closest sequence found?
Alignments
Exercise 12 Identify a conserved motif in the superfamily.
Exercise 13 According to the alignments, are the detected sequences all homologous to our query?
Decrease in the word size
Exercise 14 What might be the consequences of a decrease in word size?
Repeat the search with the parameters used in question 4 but with a word size of 3 aa.
Exercise 15 How many “hits” are you getting now?
Exercise 16 In which taxon (taxa) are similar proteins found?
Localisation of a transcript on a genome and search for a CDS
A gene has been detected as being over-expressed in several patients with esophageal cancer. The sequence of the transcript is provided below.
>human mRNA
GTGTGGACACTCCTAGGTTAGAAAGTTTGGTATGTTGCTATACCTTTGCTTCTCCCACCT
TCCCCAATATCTAATATGTATTTCTCATTCTTAGAATAATCCAGAATGGCTACTCTGATC
TATGTTGATAAGGAAAATGGAGAACCAGGCACCCGTGTGGTTGCTAAGGATGGGCTGAAG
CTGGGGTCTGGACCTTCAATCAAAGCCTTAGATGGGAGATCTCAAGTTTCAACACCACGT
TTTGGCAAAACGTTCGATGCCCCACCAGCCTTACCTAAAGCTACTAGAAAGGCTTTGGGA
ACTGTCAACAGAGCTACAGAAAAGTCTGTAAAGACCAAGGGACCCCTCAAACAAAAACAG
CCAAGCTTTTCTGCCAAAAAGATGACTGAGAAGACTGTTAAAGCAAAAAGCTCTGTTCCT
GCCTCAGATGATGCCTATCCAGAAATAGAAAAATTCTTTCCCTTCAATCCTCTAGACTTT
GAGAGTTTTGACCTGCCTGAAGAGCACCAGATTGCGCACCTCCCCTTGAGTGGAGTGCCT
CTCATGATCCTTGACGAGGAGAGAGAGCTTGAAAAGCTGTTTCAGCTGGGCCCCCCTTCA
CCTGTGAAGATGCCCTCTCCACCATGGGAATCCAATCTGTTGCAGTCTCCTTCAAGCATT
CTGTCGACCCTGGATGTTGAATTGCCACCTGTTTGCTGTGACATAGATATTTAAATTTCT
TAGTGCTTCAGAGTTTGTGTGTATTTGTATTAATAAAGCATTCTTTATCAGAAAAAAAAA
AAAAAAALocalization of a mRNA sequence on a genome
Localize the corresponding gene on the human genome with BLAST (BLAST Genomes section, at the bottom of the page). Use the GRCh38.p14 reference assembly.
Program
MEGABLAST is proposed by default.
Exercise 17 What is the word size in MEGABLAST? Can we use MegaBLAST in our case or should we use BLASTN?
Analysis
Exercise 18 Comment obtained results (number of hits, conservation…)
Exercise 19 Give the localization of the transcribed region (chromosome, strand, start, end).
Exercise 20 How many exons are present in this gene? Can you give the precise boundaries of exons?
Exercise 21 How can you explain the ranking provided by BLAST?
Exercise 22 Which program can be used to improve your results? Compare results.
Localization of the coding sequence (CDS)
Exercise 23 How could we localize the coding region of this transcript?
Exercise 24 Perform the similarity search in SwissProt.
Exercise 25 What are the boundaries and reading frame of the CDS?